Skie Nightfall

: skiehawk; October 27th, 2011

Current Mood:: sad

Was one of these days where everything goes wrong. In summary:
Starting with a car accident, proceeding to my laptop gpu dying and rendering my laptop dead.
Bats kept eating me, though mostly worried about tomorrow where I'll need to feed the biters on my own. Bad day at the office you call that.
And in end, midnight my time, DarkRaccoon killed himself :(

Arf. Here's something cute to cheer up though: http://www.furaffinity.net/view/6747651

Seeking Old Animations...

: skiehawk; August 27th, 2011

... that certainly had a role in my furryness.

Sandokan - http://en.wikipedia.org/wiki/Sandokan#Animated_series
Other then the 9 eps that are available on DVD I can't find the rest of them :(
Simba the King Lion - http://www.youtube.com/watch?v=fLj6WmWN1Cg
Can't find anything of that. Pretty neat series.

Any help would be appreciated.

Tags: sandokan, simba the king lion

Leave a comment

Eurofurence 17 (in short)

: skiehawk; August 27th, 2011

Current Location:: Home

Great times.

Started with a nice holiday at Paris with my sister, which was awesome.
EF itself was as great as always. I'm very happy we managed to pull some needed room parties that were lacking at the past.
I felt tired throughout most of the convention, I'm certainly not as fit as I used to.
Ringberg was full of memories.

Tags: 17, 2011, convention, eurofurence, eurofurence 16, furry

Leave a comment

Eurofurence 17

: skiehawk; July 20th, 2011

My first ever sheep thing.

( Lookie here... )

Tags: 17, eurofurence, sheep

Leave a comment

Just To Be Clear

: skiehawk; July 13th, 2011

Current Location:: Dorms

Current Mood:: busy

I'm not against alcohol, and I'm not against drugs.

I'm against addicts and puppets.

http://www.youtube.com/watch?v=xVR4bkyMykA

Fact is:
10% of the alcohol consumers I know/knew are/were addicts.
90% of the drug consumers I know/knew are/were addicts.

So you make the math why I tend to dislike drug users.
It's all a matter of consumption.

So, go on, keep convincing yourself.

http://www.youtube.com/watch?v=Cklb7L0OA1c

Leave a comment

Random News

: skiehawk; April 26th, 2011

Current Location:: Chemistry/Biolody Library, Technion

Current Mood:: tired

Megadeth concert was fucking awesome. Best concert I ever been it. Lots of crazy fun. And I even managed to get myself a pick signed by one of them :)
School still sucks, but holiday vacation was good ^^
Regarding my old post about sports: Damn it! San Antonio is losing :O I mean WTF? You #1 in the west and you're losing to #8, that's just fail.
Can't wait for Eurofurence, flights are all booked ^.^ Gonna visit France and Italy too.
Can't remember anything else so... Cheers ^.^

Tags: concert, eurofurence, megadeth, nba, random, san antonio, school, sports, spurs, technion

Leave a comment

Helena

: skiehawk; March 29th, 2011

Current Location:: Dorms

Current Mood:: full

For those who wonder, that DNA sequence means I belong to "clan mother" Helena.

For more information:

http://en.wikipedia.org/wiki/The_Seven_Daughters_of_Eve

http://www.mun.ca/biology/scarr/Seven_Daughters_of_Eve_7x9b.jpg

Tags: dna, helena, mitochondria, sequence

Leave a comment

This Is Mine

: skiehawk; March 28th, 2011

Current Location:: Dorms

Current Mood:: calm

CNNANTTTACATATCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCA
CCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC
TGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGT
AGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAG
CAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAA
GCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT
ACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCC
CTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACC
ATCCTCCGTGAAATCAAAAAAGTAAGTTGTGGCGCTGTTATCACTGGTGG
TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCAGTAAGATGC
TTTTTTGTTACTGGGGAGTACTCAACCAAGTCATTCTGAGAATAGTGTAT
GCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACAACATAATACCGCGA
CACATAACAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGAG
CGAAGACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACC
CACTCGTGCACCCAACTGATCTTCACATCTTTTACTTTCACCAGCGTTTC
TGGAGTGAGCAAAGAACAGGAAAGCGAAATGCCGCAAAAAACGGAATAAA
GGCGACACGGACATGTTGAATACTCATACTCTTCCTTGTTCTATATTATT
GAAGCATTATCAAGTATTCNG

Tags: dna, genetics, mitochondria, personal, sequence

The Story of the Ticket

: skiehawk; February 24th, 2011

Current Location:: Home

Current Music:: Mind.In.A.Box - R.E.T.R.O

So I really wanted to go see them live, especially in the correct line up. Since my sister lives at Europe and I got a nice holiday from school in April, I tried to see if I can catch them at Europe.

At first, the dates clashed. Then school clashed.
On 11/2 school changed some dates, and other stuff got turned around so I could actually go see them at the NL, their last European gig on the tour.
I started checking how I'm making it, but then on the 13/2...

February 13, 2011 - ISRAELI DATE ADDED TO 'EUROPEAN CARNAGE' TOUR
Megadeth is confirmed to headline a show on April 16, 2011 in Tel Aviv, Israel. The date in Tel Aviv will be the final stop for the band on the "European Carnage" spring tour which kicks off in Kiev, Ukraine on March 13.

*giggles* Guess I won't be flying this April to catch a concert :)

So today I bought this...

Tags: concert, israel, megadeth, yay!

Leave a comment

Lack of LJ Activity From Me

: skiehawk; February 16th, 2011

Current Location:: Dorms

Current Music:: Faith No More

Hi all,

I'm too busy at school at the moment, hence I don't post much and also I don't reply much to my friends posts.
So I just wanted to let you know that I do follow and read your posts at times, but I just can't go back and comment about all that I've missed.

Also, it seems the my LJ posting/editing clashes with Firefox's Adblock Plus plug in. Which means I need to switch to IE or disable it every time I want to post something. I can't live without this plug in. I wonder if it will also happen on my desktop's firefox... hmmm will have to check when I'm home.

Previous 10

skiehawk

Skie Nightfall